Research Article | Volume 3 Issue 2 (July-Dec, 2022) | Pages 1 - 4
Molecular Study of Staphylococcus Aureus Isolated From Uti Patients in Thi-Qar Province
 ,
 ,
1
College of Health & Medical Technology, AL- Ayen University, Iraq, 64001
2
College Medical Technology, Alfarahidi University, Baghdad, Iraq, 10022
3
College of Science, Mustansiriyah University, Baghdad, Iraq, 14022
Under a Creative Commons license
Open Access
Received
June 15, 2022
Revised
July 9, 2022
Accepted
Oct. 20, 2022
Published
Oct. 30, 2022
Abstract

UTIs are one of the most frequent infectious illnesses in both clinical and community settings. In the case of UTI, the presence of Gram-positive bacteria cannot be ruled out. One of the agents implicated in the infection that might infiltrate the urinary system is Staphylococcus aureus. One of the agents implicated in the infection that might infiltrate the urinary system is Staphylococcus aureus. Although S. aureus is responsible for 0.5–6% of UTIs. This study aims to detect the molecular genotyping and genetic variation of S. aureus isolated from UTIs patients after its isolation and diagnosis, depending on the cultural and biochemical examinations and confirmation by API-20 and Vitek2 compact systems. During the months of February to June 2021, 200 clinical (urine) specimens were gathered from patients who suffer from UTIs at AL-Hussein Teaching Hospital in AL-Nasiriyah City, South Iraq.  diagnostic results show that 133 out of the 200 specimens gave positive bacterial cultures  as Staphylococcus aureus. S. aureus isolates from UTI patients were tested for the existence of the (spa) gene using PCR. An individual band corresponds to each gene on the DNA ladder (1500-100bp). All S. aureus isolates (n=55) were amplified to (spa) gene at (1400-260 bp) with a positive reaction of 55 (100%), with the genotyping of this gene. also, (tst-1) gene detected in (20%) of all S. aureus isolates with a molecular size of (538bp). In a DNA sequencing analysis method , the genetic variation  (substitution Mutations) analysis in v immunoglobulin G binding protein A (spa) gene between local  S. aureus  isolates (IQ-UTI.1 - IQ-UTI.2)  and NCBI-Blast related S. aureus isolate were   find 4 into 5 substitution mutations at total genetic variation percentage ranged (0.84-1.05%).While the genetic variation   analysis in toxic shock syndrome toxin- 1 (tsst-1) gene between local  S. aureus   isolates (IQ-UTI.3)  and NCBI-Blast related  S. aureus isolate were find one substitution mutation at total genetic variation percentage ranged (0.23%).

Keywords
Important

Key findings:

Key findings include: 133 out of 200 clinical urine specimens from UTI patients at AL-Hussein Teaching Hospital in AL-Nasiriyah City, South Iraq, tested positive for Staphylococcus aureus; all S. aureus isolates (n=55) amplified the spa gene (100%) and 20% tested positive for the tst-1 gene; genetic variation analysis revealed substitution mutations in the spa and tst-1 genes.

What is known and what is new?

The known aspect is the prevalence of Staphylococcus aureus in UTIs, with S. aureus responsible for 0.5–6% of cases. The new contribution is the molecular genotyping and genetic variation analysis of S. aureus isolates from UTI patients in South Iraq, highlighting the presence of spa and tst-1 genes and identifying substitution mutations in these genes.

What is the implication, and what should change now?

The implication of this study is the need for improved diagnostic methods and targeted treatment strategies for Staphylococcus aureus UTIs, given the high prevalence and genetic variability of the pathogen. Changes needed include incorporating molecular genotyping into routine diagnosis, monitoring antibiotic resistance patterns, and developing novel antimicrobial therapies to combat S. aureus UTIs effectively.

INTRODUCTION

In the Firmicutes family, Staphylococcus aureus refers to a Gram-positive, round-shaped bacteria. The microbiota of the upper respiratory tract and the skin frequently include this organism. It is a facultative anaerobic anaerobic with catalase and nitrate reduction .[1] Although S. aureus is a common commensal in the human microbiome, it can cause skin infections like abscesses, respiratory infections like sinusitis, and food poisoning. A cell-surface protein that attaches to and inactivates antibodies is widely involved in the promotion of infections. A cell-surface protein that attaches to and inactivates antibodies is widely involved in the promotion of infections. Although substantial research and development have taken place, no anti-S. The aureus vaccine has yet to be approved.

 

S. aureus long-term carriers are considered to account for between 20% and 30% of the world's human population, according to some estimates [2-3]. The most prevalent human and animal infection among staphylococci is Staphylococcus aureus, an opportunistic bacterium that generates golden pigment. [4] The coagulase test is the simplest laboratory method to distinguish the S. aureus from the coagulase-negative staphylococci, also S. aureus can also be detected or confirmed by polymerase chain reaction (PCR) technique [5]). Humans are infected with a wide variety of S. aureus strains. The clinical diseases caused by S. aureus are classified as nosocomial or community, depending on the source of the infection [6]. These two types are different in the clinical signs of the disease, the genetic related of the infecting S. aureus strains and the antimicrobial susceptibility [7].

 

 S. aureus is a human pathogen. S. aureus is a typical microbe that inhabits the upper respiratory system, stomach mucosa, and skin.[8-10] However, since S. Aureus is classified as a "pathobiont" because it may cause illness in specific hosts and environments.[8]

MATERIALS AND METHODS

Methods

Samples Collection

Urine samples were taken from 200 patients of all ages, both male and female who suffered from symptom-based UTIs and who were diagnosed by a physician and microscopic examination. Patients took care and medication at AL-Hussain Teaching Hospital in AL- Nasiriyah City, South Iraq from February to June 2021. Samples (Middle Stream Urine) were taken from patients in “a clean, sterile, dry and wide-necked leak-proof container.”Samples were properly labeled at the collection point and immediately transported to the investigated laboratory for microscopy, culture, and sensitivity analysis.

 

1. Preparation of cultural media

All media were made depending on instructions from the maker, then autoclaved at 121°C for 15 minutes at 15 pounds/Inch2 and dispersed onto sterile Petri plates or tubes, where they solidified at room temperature. The Petri dishes were sterilized by incubating at 37°C for 24 hours. Some of these media need special additives. After that they were ready to use for isolation of bacteria or kept at 4 °C.

 

2. Blood agar

It was created by mixing 40 gm of blood agar foundation powder in 1 liter of distilled water, heating to boiling with frequent agitation to fully dissolve the medium, then autoclaving for 15 minutes at 15 pounds/Inch2 at 121°C. The temperature of the media was reduced to 50 °C. in water bath, then aseptically adding 5% v\v of sterile human blood , after that mixed well to homogeneity, then let aside to solidify at room temperature in sterilized Petri-dishes. After 24 hours of sterilizing at 37°C, the Petri dishes were available for initial isolation and culture of hemolysin-producing bacterial isolates or kept at 4°C until use.

 

Identification of Staphylococci

Staphylococci was identified according to the morphological features (colony size, translucency, color, shape, edge, hemolysis, elevation, and texture) on culture media and biochemical tests.

 

3.2.4.3. Culturing of Samples

The specimens were labeled and grown under aerobic conditions on blood agar and MacConkey agar for urine samples and incubated overnight at 37˚C in the incubator.

 

3.2.4.4. Microscopically examination

In order to examine the bacterial cell under the microscope, the loop contains D.W. and a single N.A.C. colonies may be picked up and distributed on a clean slide (oil immersion).

 

Molecular Detection of Staphylococcus aureus

In UTI infection S. aureus isolates, PCR was used to detect the based Staphylococcus aureus protein A (spa) and toxic shock syndrome toxin-1 (tst-1) genes. All PCR primers that used in these technique were designed in this study

 

Bacterial DNA extraction

S. aureus genomic DNA was isolated using the PrestoTM Mini gDNA Bacteria Kit.

 

1 Standard PCR master mix protocol

PCR Master mixVolume
DNA template 5-50 ng5µL
Forward primer (10 pmol)2µL
Reverse primer (10 pmol)2µL
GoTaq Green PCR master12.5µL
PCR water3.5µL
Total volume25 µL

Primers

This work used the NCBI-Genbank database and primer3 plus online to develop PCR primers for detecting Staphylococcus aureus protein A (spa) and toxic shock syndrome toxin-1 (tst-1) genes. Scientific Resercher.Co.Ltd in Iraq provided these primers, which are listed in table:1

 

The PCR primers with their nucleotide sequence and product size

PrimerSequence (5'-3')Product SizeGenbank
Staphylococcus aureus protein A (spa)FTATAGTTCGCGACGACGTCC705bpJQ066313.1
RAGCACCAAAAGCTGACAACA
toxic shock syndrome toxin-1 (tst-1) geneFCCCTTTGTTGCTTGCGACAA538bpMH920616.1
RACCACCCGTTTTATCGCTTG


 

 

Gel Electrophoresis Solution

This solution was made by weight Agarose powder (1 g in the case of DNA extraction and 2 g for PCR product detection) was liquefied  in 100 ml of 1X TBE buffer and after that it was heated and stirred to make it solubilized, then added 2 μL of ethidium bromide dye ware added (Nucleic Acid Staining Solution).

RESULT

Detection of spa Gene in S. aureus

In the current investigation, the existence of the (spa) gene in S. aureus isolates from UTI patients was detected using the PCR technique. Each gene is displayed by a single band in the relevant section of the DNA ladder, which represents the gene's location (1500-100bp). All S. aureus isolates (n=55) were amplificated to spa gene at (1400-260 bp) with a positive reaction of 55 (100%)

 

Figure 4.15: 1 Agarose gel electrophoresis picture of the PCR product analysis of the Staphylococcus aureus protein a (spa) gene in Staphylococcus aureus isolates from urinary tract infections. Where the marker ladder (1500-100bp) and lane (1-24) revealed some positive spa gene at (1400-260 bp) PCR product size.

 

Detection of tst-1 Gene in S. aureus

The occurrence of the (tst-1) gene in S. aureus isolated from UTI patients was discovered in this study utilizing the PCR method. Each gene is represented by a single band in the DNA ladder's corresponding region (1500-100bp). All S. aureus isolates (n=55) were amplificated to tst-1 gene at (538bp) with a positive reaction of 11 (20%)

 

Figure 4.15: 1 Agarose gel electrophoresis picture of the PCR product analysis of the toxic shock syndrome toxin-1 (tst-1) gene in Staphylococcus aureus isolates from urinary tract infections. Where lane (1-20) exhibited some positive tst-1 gene at (538bp) PCR product size, and marker ladder (1500-100bp)

 


 

The polymorphism in the gene that codes for a protein. People are typing in a spa. In addition to the five IgG binding sites (A, B, C, D, and E), Protein A features a cell wall attachment domain at the C-terminus. The Fc-binding domain of the protein spa is encoded by one region, whereas the X region is encoded by the other [9].

 

The Spa type method exploits tandem repeats and sequence diversity in protein region X. Gene. Several investigations have shown varied spa gene patterns across S. aureus strains obtained from patients in various parts of the world [10].

 

In the current investigation, the genotypic identification rate of spa gene in UTIs samples was 24(100%) with different number of repeat polymorphism site, especially in UTI.17 with four sites, band size (1400-260 bp) and IgG binding sites, the result of the current study seems to be in agreement with (Goudarzi, Mehdi et al., 2018) [11]. but the results are not comparable with (Goudarzi, Mehdi et al., 2019) [12] they mentioned the percentage is (25.3%). These differences may be due to the sources and number of the clinical samples used, and the sensitivity of different techniques used or my be due to geographical dependency.

 

S. aureus superantigens (SAgs) are a unique group of non-glycosylated low-molecular-weight exoproteins that are very resistant to heat, acids, proteolysis, and desiccation. SAgs are also very resistant to being dehydrated [13]. This toxin family can cause excessive T-cell activation and cytokine production, affecting immune system function throughout the body.

 

Because of their biological toxicity, SAgs are important contributors to life-threatening illnesses. When expressed in a susceptible host, the toxic shock syndrome toxin-1 (TSST-1) gene codes for a member of the SAgs family of toxins that can induce staphylococcal toxic shock syndrome (TSS) [13].

 

In the current work,  all S. aureus isolates were amplificated to tst-1 gene at (538bp)  with a positive reaction of 4 (20%),it is nearly similar to (Alni, Reza Hakimi et al.,2018), (Wang, Min et al.,2017) [14-15] they mentioned the percentage is (22%),(18%) correspondingly. The tst-1 gene ratio was slightly higher in other studies, with the tst-1 gene being found in (26.31%) and (44.4%) tst-1-positive. [11, 16]

Funding:

No funding sources.

Conflict of interest:

None declared.

Ethical approval:

The study was approved by the Institutional Ethics Committee of Alfarahidi University.

REFERENCES
  1. Masalha, Mahmud, et al. "Analysis of transcription of the Staphylococcus aureus aerobic class Ib and anaerobic class III ribonucleotide reductase genes in response to oxygen." Journal of bacteriology 183.24 (2001): 7260-7272. https://doi.org/10.1128/jb.183.24.7260-7272.2001 

  2. Kluytmans, J. A. N., Alex Van Belkum, and Henri Verbrugh. "Nasal carriage of Staphylococcus aureus: epidemiology, underlying mechanisms, and associated risks." Clinical microbiology reviews 10.3 (1997): 505-520. https://doi.org/10.1128/cmr.10.3.505 

  3. Tong, Steven YC, et al. "Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management." Clinical microbiology reviews 28.3 (2015): 603-661. https://doi.org/10.1128/cmr.00134-14 

  4. Markey, B.K.; Leonard, F.C.; Archambault, M. Cullinane, A. and Maguire, D. (2014). Clinical Veterinary Microbiology. 2nded. Mosby Elsevier. Pp. 105-120. https://doi.org/10.1016/B978-0-7234-3651-4.00008-7.

  5. Becker, Karsten, Christine Heilmann, and Georg Peters. "Coagulase-negative staphylococci." Clinical microbiology reviews 27.4 (2014): 870-926. https://doi.org/10.1128/cmr.00109-13 

  6. Khan, Hassan Ahmed, Aftab Ahmad, and Riffat Mehboob. "Nosocomial infections and their control strategies." Asian pacific journal of tropical biomedicine 5.7 (2015): 509-514. https://doi.org/10.1016/j.apjtb.2015.05.001 

  7. Becker, Karsten, Christine Heilmann, and Georg Peters. "Coagulase-negative staphylococci." Clinical microbiology reviews 27.4 (2014): 870-926. https://doi.org/10.1128/cmr.00109-13 

  8. Schenck, Louis Patrick, Michael G. Surette, and Dawn ME Bowdish. "Composition and immunological significance of the upper respiratory tract microbiota." FEBS letters 590.21 (2016): 3705-3720.https://doi.org/10.1002/1873-3468.12455 

  9. Harmsen, Dag, et al. "Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting by using novel software for spa repeat determination and database management." Journal of clinical microbiology 41.12 (2003): 5442-5448. https://doi.org/10.1128/jcm.41.12.5442-5448.2003 

  10. Furuya, Daisuke, et al. "Evaluation of spa typing for the classification of clinical methicillin-resistant Staphylococcus aureus isolates." Japanese journal of infectious diseases 63.5 (2010): 364-367.https://doi.org/10.7883/yoken.63.364 

  11. Goudarzi, Mehdi, et al. "SCCmec and spa typing of Staphylococcus aureus strains isolated from patients with urinary tract infection: emergence of spa types t426 and t021 in Iran." Jundishapur Journal of Microbiology 11.5 (2018).https://brieflands.com/articles/jjm-62169.pdf 

  12. Goudarzi, Mehdi, et al. "Genetic diversity and biofilm formation analysis of Staphylococcus aureus causing urinary tract infections in Tehran, Iran." The Journal of Infection in Developing Countries 13.09 (2019): 777-785.https://doi.org/10.3855/jidc.11329 

  13. Spaulding, Adam R., et al. "Staphylococcal and streptococcal superantigen exotoxins." Clinical microbiology reviews 26.3 (2013): 422-447.https://doi.org/10.1128/cmr.00104-12 

  14. Alni, Reza Hakimi, et al. "Detection of toxic shock syndrome toxin (TSST) gene among staphylococcus aureus isolated from patients and healthy carriers." Avicenna Journal of Clinical Microbiology and Infection 5.1 (2018): 14249-14249.https://ajcmi.umsha.ac.ir/PDF/ajcmi-5-14249.pdf 

  15. Wang, Min, et al. "Hospital dissemination of tst-1-positive clonal complex 5 (CC5) methicillin-resistant Staphylococcus aureus." Frontiers in Cellular and Infection Microbiology 7 (2017): 101. https://doi.org/10.3389/fcimb.2017.00101 

Costa, F. N., et al. "Frequency of enterotoxins, toxic shock syndrome toxin-1, and biofilm formation genes in Staphylococcus aureus isolates from cows with mastitis in the Northeast of Brazil." Tropical animal health and production 50 (2018): 1089-1097. https://link.springer.com/article/10.1007/s11250-018-1534-6

Funding:

No funding sources.

Conflict of interest:

None declared.

Ethical approval:

The study was approved by the Institutional Ethics Committee of Alfarahidi University.

REFERENCES
  1. Masalha, Mahmud, et al. "Analysis of transcription of the Staphylococcus aureus aerobic class Ib and anaerobic class III ribonucleotide reductase genes in response to oxygen." Journal of bacteriology 183.24 (2001): 7260-7272. https://doi.org/10.1128/jb.183.24.7260-7272.2001 

  2. Kluytmans, J. A. N., Alex Van Belkum, and Henri Verbrugh. "Nasal carriage of Staphylococcus aureus: epidemiology, underlying mechanisms, and associated risks." Clinical microbiology reviews 10.3 (1997): 505-520. https://doi.org/10.1128/cmr.10.3.505 

  3. Tong, Steven YC, et al. "Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management." Clinical microbiology reviews 28.3 (2015): 603-661. https://doi.org/10.1128/cmr.00134-14 

  4. Markey, B.K.; Leonard, F.C.; Archambault, M. Cullinane, A. and Maguire, D. (2014). Clinical Veterinary Microbiology. 2nded. Mosby Elsevier. Pp. 105-120. https://doi.org/10.1016/B978-0-7234-3651-4.00008-7.

  5. Becker, Karsten, Christine Heilmann, and Georg Peters. "Coagulase-negative staphylococci." Clinical microbiology reviews 27.4 (2014): 870-926. https://doi.org/10.1128/cmr.00109-13 

  6. Khan, Hassan Ahmed, Aftab Ahmad, and Riffat Mehboob. "Nosocomial infections and their control strategies." Asian pacific journal of tropical biomedicine 5.7 (2015): 509-514. https://doi.org/10.1016/j.apjtb.2015.05.001 

  7. Becker, Karsten, Christine Heilmann, and Georg Peters. "Coagulase-negative staphylococci." Clinical microbiology reviews 27.4 (2014): 870-926. https://doi.org/10.1128/cmr.00109-13 

  8. Schenck, Louis Patrick, Michael G. Surette, and Dawn ME Bowdish. "Composition and immunological significance of the upper respiratory tract microbiota." FEBS letters 590.21 (2016): 3705-3720.https://doi.org/10.1002/1873-3468.12455 

  9. Harmsen, Dag, et al. "Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting by using novel software for spa repeat determination and database management." Journal of clinical microbiology 41.12 (2003): 5442-5448. https://doi.org/10.1128/jcm.41.12.5442-5448.2003 

  10. Furuya, Daisuke, et al. "Evaluation of spa typing for the classification of clinical methicillin-resistant Staphylococcus aureus isolates." Japanese journal of infectious diseases 63.5 (2010): 364-367.https://doi.org/10.7883/yoken.63.364 

  11. Goudarzi, Mehdi, et al. "SCCmec and spa typing of Staphylococcus aureus strains isolated from patients with urinary tract infection: emergence of spa types t426 and t021 in Iran." Jundishapur Journal of Microbiology 11.5 (2018).https://brieflands.com/articles/jjm-62169.pdf 

  12. Goudarzi, Mehdi, et al. "Genetic diversity and biofilm formation analysis of Staphylococcus aureus causing urinary tract infections in Tehran, Iran." The Journal of Infection in Developing Countries 13.09 (2019): 777-785.https://doi.org/10.3855/jidc.11329 

  13. Spaulding, Adam R., et al. "Staphylococcal and streptococcal superantigen exotoxins." Clinical microbiology reviews 26.3 (2013): 422-447.https://doi.org/10.1128/cmr.00104-12 

  14. Alni, Reza Hakimi, et al. "Detection of toxic shock syndrome toxin (TSST) gene among staphylococcus aureus isolated from patients and healthy carriers." Avicenna Journal of Clinical Microbiology and Infection 5.1 (2018): 14249-14249.https://ajcmi.umsha.ac.ir/PDF/ajcmi-5-14249.pdf 

  15. Wang, Min, et al. "Hospital dissemination of tst-1-positive clonal complex 5 (CC5) methicillin-resistant Staphylococcus aureus." Frontiers in Cellular and Infection Microbiology 7 (2017): 101. https://doi.org/10.3389/fcimb.2017.00101 

Costa, F. N., et al. "Frequency of enterotoxins, toxic shock syndrome toxin-1, and biofilm formation genes in Staphylococcus aureus isolates from cows with mastitis in the Northeast of Brazil." Tropical animal health and production 50 (2018): 1089-1097. https://link.springer.com/article/10.1007/s11250-018-1534-6

License
CC BY-NC-ND
Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License
Molecular Study of Staphylococcus Aureus Isolated From Uti Patients in Thi-Qar Province © 2026 by Amran M. AL-Erjan, Mustafa Jawad Kadham, Rawaa Najim Alkhamessi licensed under CC BY-NC-ND 4.0
All papers should be submitted electronically. All submitted manuscripts must be original work that is not under submission at another journal or under consideration for publication in another form, such as a monograph or chapter of a book. Authors of submitted papers are obligated not to submit their paper for publication elsewhere until an editorial decision is rendered on their submission. Further, authors of accepted papers are prohibited from publishing the results in other publications that appear before the paper is published in the Journal unless they receive approval for doing so from the Editor-In-Chief.
Himalayan Journal of Applied Medical Sciences and Research open access articles are licensed under a Creative Commons Attribution-Share A like 4.0 International License. This license lets the audience to give appropriate credit, provide a link to the license, and indicate if changes were made and if they remix, transform, or build upon the material, they must distribute contributions under the same license as the original.
Recommended Articles
Research Article
Ethnomedicinal Plants for Obesity Management - Phytochemicals, Molecular Targets and Prospects of Green Nanotechnology
Published: 25/03/2026
Download PDF
Research Article
Digital Implantology: Current Concepts, Clinical Applications, Limitations and Future Directions - A Narrative Review
Published: 30/07/2026
Download PDF
Research Article
Study of the Role of Serum Interleukin-6 in Inflammation among Pregnant Women with COVID-19
Published: 27/07/2021
Download PDF
Research Article
Bones in Balance: Awareness of Rickets and Nutritional Deficiencies Among the Hamirpur Community
Published: 10/12/2024
Download PDF
Flowbite Logo
Najmal Complex,
Opposite Farwaniya,
Kuwait.
Email: support@himjournals.com

Useful Links
Order Hard Copy
Privacy policy
Terms and Conditions
Refund Policy
Others
About Us
Team Members
Contact Us
Online Payments
Join as Editor
Join as Reviewer
Subscribe to our Newsletter
Follow us
MOST SEARCHED KEYWORDS
scientific journal
 | 
business journal
 | 
medical journals
 | 
Scientific Journals
 | 
Academic Publisher
 | 
Peer-reviewed Journals
 | 
Open Access Journals
 | 
Impact Factor
 | 
Indexing Services
 | 
Journal Citation Reports
 | 
Publication Process
 | 
Impact factor of journals
 | 
Finding reputable journals for publication
 | 
Submitting a manuscript for publication
 | 
Copyright and licensing of published papers
 | 
Writing an abstract for a research paper
 | 
Manuscript formatting guidelines
 | 
Promoting published research
 | 
Publication in high-impact journals
Copyright © Himalayan Journals . All Rights Reserved.